Activité 2 - La synthèse des protéines

Activité 2 – La synthèse des protéines

Problématique : Comment se fait la correspondance entre la séquence des nucléotides de l'ARN et la séquence

des acides aminés des protéines ?

A – La découverte du code génétique

1

Combien faut-il de nucléotides pour coder 1 acide aminé ?

       Pour y répondre : combien de combinaisons différentes obtient-on :

         - si l'on considère qu'un nucléotide seul code pour un acide aminé,

         - si l'on considère que deux nucléotides codent pour un acide aminé,

         - si l'on considère que trois nucléotides codent pour un acide aminé,

Rmq : Dans une combinaison, un nucléotide peut être utilisé plusieurs fois et l'ordre a une importance.

Livre p 41 doc. 3

Document 1

Mettre en œuvre une pratique documentaire pour comprendre comment le code génétique a été élucidé.

2

Déterminez les acides aminés codés par les codons UUU, AAA, UCU et CUC.

Livre p 43 doc. 2

 

 

 

B – La traduction

3

Réalisez la manipulation proposée avec Anagène.

Quel est le codon qui initie la séquence codante de l'ARN ?Quelle est la fonction des codons UGA, UAG et UAA ?

Livre p 43 doc. 3

Logiciel Anagène

Document 4

 

 

Utiliser un logiciel permettant d'approcher le mécanisme

 

de la transcription et de la traduction

4

En utilisant le code génétique, écrivez les séquences d'acides aminés correspondant à la séquence nucléotidique proposée.

Document 2

Document 4

5

En utilisant le logiciel ADN/ARN, écrivez les séquences d'acides aminés correspondant à la séquence nucléotidique proposée.

Logiciel ADN/ARN

Document 3

 

 

Document 1 : La transcription et la traduction

 

La première étape de la synthèse des protéines est la transcription. Il s'agit de la synthèse d'ARN à partir d'ADN. Une molécule d'ARN est une reproduction fidèle de l'ADN dont il est issu. Cependant il possède 1 seul brin (au lieu de 2) et les nucléotides Thymine sont remplacés par des nucléotides Uracile.

 

La deuxième étape de la synthèse des protéines est la traduction. Il s'agit pour les ribosomes de "lire" la séquence nucléotidique portée par l'ARN et de faire concorder les acides aminés correspondants.

 

L'alphabet nucléotidique comprend 4 nucléotides : A, U, C et G. L'alphabet protéique comprend 20 acides aminés. Il existe donc un code de correspondance entre ces deux langages : le code génétique.

 

 

Document 2 : Séquence d’ADN, brin non transcrit

 

ATGGCCGAGGTGTTGCGGACGCTGGCCGGAAAACCAAAATGCCACGCACTTCGACCTACGATCCTTTTCCTGGGAGGGAGGGCACATTCAACATCGACATCCTCAACGAGCAGTTCAGGCTCCAGAACACCACCATTGTAA

 

Document 3 : Un logiciel de transcription/traduction

 

Dans le dossier “Logiciels SVT” ouvrez le logiciel “adnarn”.

Vous êtes dans le menu principal.

 

1 – Transcription :

Cliquez sur "3 – Transcription (commencer par le brin codant)

         "1 - Saisissez la séquence du brin codant"

Tapez :                ATGACAAATGAGCGTCCAGGCCTGAAATGA

         "2 – Saisissez la séquence complémentaire"

         "3 – Saisissez la séquence de l'ARN messager"

Cliquez sur "Quitter" pour revenir au menu principal.

 

2 – Traduction :

Cliquez sur "4 – Traduction"

         1 – Saisissez la séquence de l'ARN messager trouvé ci-dessus.

2 – Cliquez sur "I – Initiation" puis entrez le nom de l'acide aminé

correspondant au premier codon (aidez-vous de "? Code génétique").

3 – Cliquez sur "II – Elongation" puis entrez le nom de l'acide aminé correspondant au deuxième codon. Répétez l'opération jusqu'au sixième

codon.

4 – Cliquez sur "III – Terminaison".